Human Variation & Race

High Altitude- Humans evolved in lower altitudes and when exposed to HIGH altitudes many factors are compromised and result in stress. The body can suffer from hypoxia (Insufficient levels of oxygen in the body tissue), more intense solar radiation, cold temperatures, low humidity, wind, reduced nutritional base, and rough terrain. Hypoxia would be the one that disturbs human homeostasis the most, since it'll affect the heart, lungs and brain. Pregnant woman were affected by preeclampsia (a severe elevation in blood pressure) causing increased infant mortality rates, miscarriages, low birth rates, and premature births. 

Adaptions-
1. When people born in LOW elevations and travel to HIGH elevations the process of acclimatization begins with in one or two days. This process will increase metabolic rate, respiration, heart rate, and production of red blood cells. With high altitude natives acclimatization occurs during growth and development, they will also have greater lung and heart capacity. 

Initial inefficient response to low oxygen pressure

2. The common solution of Tibetans who live at high altitudes generally has been to breathe faster in order to take in more oxygen  and to have broader arteries and capillaries, thereby allowing much higher rates of blood flow and subsequently greater amounts of oxygen delivered to their muscles, despite the fact that they have relatively normal hemoglobin levels.  A recent study shows that 90% of Tibetans have a gene called EPAS1, which inhibits the increased production of red blood cells.



3. Glucose burns in a way that permits more efficient oxygen use. This implies the genetic mutation in the mitochondrial DNA, and it also implies that natural selection has acted to increase the frequency of these advantages in these groups. 

4. For non natives, rest and less extenuating activities would be best if they are in high altitudes. They will be able to preserve their oxygen levels and won't feel or encounter signs of hypoxia. 

Benefits- I believe that the benefits of studying these environmental clines is that it helps science understand the adaption and changes possible by the human body. How the human body adapts to fight or flight situation like Tibetans breathing faster to take in more oxygen and being able to basically maintain a good balance of oxygen in their bodies. Scientist can take this information and gather more and more date as other kinds of populations are exposed to these climate changes/altitudes. 

I would use race to classify groups depending on their geological location, not every race is going to live in high altitudes or ever even be exposed to it. You could use race to see how their ancestors adapted million years ago and to understand why a certain race will have a particular gene and another races not have the same gene. It could help us predict how certain races homeostasis will react if an unpredictable climate shift were to ever occur. 

Piltdown HOAX

          Piltdown man goes back to the early 1900's in England, where an archeologist names Charles Dawson dug up what came out to be an ancient skull. The skull was half a jaw and appeared Ape like, however its teeth were flat resembling human teeth. He made this discovery with two other colleagues, Arthur Woodward and Father Pierre. The scientific discovery would have confirmed Darwin's theory of the relationship between Ape and Human, however doubts started emerging when other early human remains were found in other parts of the world. None of the fossils founds resembles a Ape like jaw like Dawson had "discovered"... It led scientist a blind ally making them believe that the human brain expanded in size before the jaw adapted.
       In 1939 a paleontologist conducted a fluorine test on the fossil, according to this test bones absorb water and soil, so fossils that would have been in the soil for the same amount of time should have the same amount of fluorine. Since examples of fossils from early humans date back 50,000 years ago and the fossil tested from Dawson being young and only a few 100 years old it threw a huge set back. The fossil was artificially stained and the teeth her manually filled down, and the jaw came from a female Orangoutang.
    Dawson did not care for his reputation, they later found out that half a dozen of his findings were forged. Scientist have to keep their integrity and remember that good science depends on objectivity. If they do not they can become vulnerable to lies, cheats, and deceptions.
    I do not think it is possible to remove the "human" factor from science, it is in our nature to make mistakes. Even the most strictest, sticklers can have mess-ups and they can learn from it, however at some point in the science process this should not longer occur. Plus without having the human factor some scientist wouldn't go with there gut in the beginning and making amazing discoveries. Piltdown man is a great example of making sure you have your concrete evidence and making sure you don't fall victim of being bias and actually evaluating the evidence. Someone can't go based of something that looks surreal only because of your greed and wanting to be recognized. This hoax is one or the books and anyone can take a lesson from it.

Homologies/Analogies

Homologous Traits

1. Two different species that possess the homologous trait would be a bats wing and a human arm. 

2. Describe the homologous trait of each species, focusing on the differences in structure and function of the trait. Why do these traits exhibit differences between the two species? 

The human arm and a bats wing is significantly different in appearance but they in fact share the Humorous, Radius, Ulna, Carpals, Metacarpals, and Phalanges. The difference in the way we use our arm is to grasp, drive, write, and basically perform daily functions. The bat will use his wings to glide in the sky and fly around, they can also wrap their wings around insects or fruit to eat. 

3. Who was (generally, not specifically) the common ancestor of these two species and how do we know that ancestors possessed this homologous trait?

The common ancestor of these two are mammals, their ancestor would have had this same limb causing them to have the homologous trait. 

4. Images 🦇💪

Analogous Traits

A. Describe two different species that possess the analogous trait- Would be the human eye and the octopus eye.

B. Describe the analogous trait of each species, focusing on the similarities instructor and function of the trait. Clearly explain why these analogous traits exhibit similarities between the two. 

The octopus and human eyes both have a "camera-type" morphology. We share an iris(pupil) which controls the amount of light reaching the retina, a lens which helps focus light and images, and a retina which converts incident light into signals that are carried to the optic nerve to the brain. The one thing that I believe the octopus has on the human eye is the "blind spot." The human eye has a blind spot in the optic disk within the retina where there is no image detection therefore the term "blind spot." The octopus does not have this which would make its eye a better structure than ours. 

C. All pair of organisms share some common ancestor if you go back far enough in time. Did the common ancestor of these two species possess the analogous trait?

I do not think that these two shared the same ancestor, at some point in time in their environment it causes them to shift into having the camera type morphology. 

D. Images 👀🐙

Protein Synthesis

CTCGTTACACCTAAGACCTCATGTGCTATAGTGGCATCGTAGT

🙋

Scientific Method

1. My hypothesis would be, is it possible that the chair the student sits on causes him to fall asleep.

2. Test
    A. I would test this hypothesis by switching the chairs in the classroom around, including this particular student.

    B. If the student still falls asleep then my hypothesis is not supported

    C. If the student stays awake my hypothesis is supported.

3. A example of a untestable explanation would be, that he dreams of the lecture while he sleeps therefore not needing to be awake and decides to sleep.

Stranded..

If I were stranded on a desert island the two things I would bring with me would be one a mirror, I could use this to make signals to any aircrafts flying by or I could break it and use it as a weapon. The second thing would be rope to make shelter and possible build a raft.